| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.062818 |
| Chromosome: | chromosome 9 |
| Location: | 6203648 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g413400 | (1 of 13) 2.7.11.1//2.7.11.25 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Mitogen-activated protein kinase kinase kinase / MLTK | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACTTTACTGGATTACCGCGTATGACGCCCCGCTACCTCCTTTGCGAA |
| Internal bar code: | CGATGGCCTCGAAAACTTTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1383 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAATGCGCCCAAGAGATT |
| Suggested primer 2: | AAGCCAGCCCATAGCCAATT |