Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.062879 |
Chromosome: | chromosome 13 |
Location: | 622519 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g565750 | EFG4 | (1 of 1) K14416 - elongation factor 1 alpha-like protein (HBS1); Translation elongation factor Tu family protein | outside_mRNA |
Cre13.g565800 | UPTG1,UPT1,RGP1,UTPG1,EZY11 | UDP-Arabinosyl mutase. .; (1 of 1) 5.4.99.30 - UDP-arabinopyranose mutase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCAATGCCAGCTCTCTATGTGCCTAGCACCCAAGCTCTATAACCACTT |
Internal bar code: | TATGTTGGTGGATAACGTATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3741 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 109 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 109 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGCATGCGCGTCTGAATTC |
Suggested primer 2: | CGTCATCGTAGCCATCGTCA |