| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.062912 |
| Chromosome: | chromosome 3 |
| Location: | 6797590 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g197100 | LRL1 | Lipid remodeling regulator 1; (1 of 2) PTHR10641:SF585 - MYB DNA-BINDING-LIKE PROTEIN | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACAGCTTAAATGCCACAGCAGAAGTACTGTCTACGACCTATTATTGAC |
| Internal bar code: | AGATGCAAAGCATGAGTAACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1440 |
| LEAP-Seq percent confirming: | 81.4815 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTACCTAGGAACGCGCTG |
| Suggested primer 2: | ACCTTCTTGATGTCTGGCCG |