| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.062950 |
| Chromosome: | chromosome 16 |
| Location: | 4875329 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687050 | (1 of 8) 2.4.1.5 - Dextransucrase / Sucrose 6-glucosyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGCACCGGCCACTCGTTGCCTCGCACCCGCAGTCTAGCCAGTTACTGC |
| Internal bar code: | TGGTCGAGCAACGCAAGGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 63 |
| LEAP-Seq percent confirming: | 3.38983 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 57 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCTCACAGTCATTGGGAA |
| Suggested primer 2: | GTGTGTGTACGTGTGTGTGC |