| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.062963 |
| Chromosome: | chromosome 10 |
| Location: | 4060161 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g447850 | YEE2 | (1 of 3) K07112 - uncharacterized protein (K07112); Integral membrane protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAATGAAACGCCGATAGTTTACGCTGCTTGTGCACTTGACACGTTGTT |
| Internal bar code: | CAGGTCCCCACTGGAAGCTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1663 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGGCTCTGCGGGATAGTC |
| Suggested primer 2: | CAAGTGCTCTAGCCCTTGCT |