| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.063001 |
| Chromosome: | chromosome 9 |
| Location: | 2613536 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g392250 | OTU5 | (1 of 2) IPR000104//IPR003323 - Antifreeze protein, type I // OTU domain; OTU-like cysteine protease | 3'UTR |
| Cre09.g392251 | (1 of 28) 2.7.7.6 - DNA-directed RNA polymerase / RNA polymerase III | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCCATGCGGACTCCATGCGGCAGCATGGCAAGCAAGCATGGTCAAGC |
| Internal bar code: | ACGCTACTTACAGAAAATATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 849 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCGGTAGGTGGTGCAAGG |
| Suggested primer 2: | AAGTGCTAGCGGACTGGTTC |