| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.063094 |
| Chromosome: | chromosome 17 |
| Location: | 73951 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g696350 | (1 of 1) PTHR12454:SF11 - PROTEIN Y57A10A.10 | 5'UTR | |
| Cre17.g696400 | CLPS1 | Clp protease adaptor protein; (1 of 1) K06891 - ATP-dependent Clp protease adaptor protein ClpS (clpS) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAGAGAAAAGCGGCCGCTTTGACTTCTACCCCCTTTTGCATTGTAGC |
| Internal bar code: | AGTTGGTAATTGATACTGCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2412 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 81 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCTGTTGAGTTGTTGTGG |
| Suggested primer 2: | CGACCCACAGCAGCCTATAG |