| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.063113 |
| Chromosome: | chromosome 12 |
| Location: | 685280 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g493000 | (1 of 1) IPR006153//IPR020846 - Cation/H+ exchanger // Major facilitator superfamily domain | 3'UTR | |
| Cre12.g801351 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGGCGCATAGCCTTAGACCGTTCAATGCGAGGGACCCGTCCTAGTGGA |
| Internal bar code: | CTGCAGGCGCCATGCTGGATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 770 |
| LEAP-Seq percent confirming: | 97.1429 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCCCATTCTCTGTGCCAT |
| Suggested primer 2: | CACCGAACCTACACGTGACA |