| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.063151 |
| Chromosome: | chromosome 3 |
| Location: | 9184101 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g199647 | EIF4A,EIF4A3 | (1 of 1) K13025 - ATP-dependent RNA helicase (EIF4A3, FAL1); Eukaryotic translation initiation factor 4A3 | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCATACATTCTTACGTTGTAGGTGCTGATATACTGCATAGCCCTGCACT |
| Internal bar code: | CTTGAATGCTTATGGGTACAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1858 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGCGGATGGCTTCTCAAA |
| Suggested primer 2: | AAGCCAATGGAGGGGAATGG |