| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.063193 |
| Chromosome: | chromosome 1 |
| Location: | 8204199 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g071662 | ACS1 | Acetyl-CoA synthetase/ligase; (1 of 3) K01895 - acetyl-CoA synthetase (ACSS, acs) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGGATGCAAGCAGATGTCTAAGTGAGGCCTGCTGAGGCCTAGTAGCAG |
| Internal bar code: | TGTGGTACTTCCGGGATGTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3247 |
| LEAP-Seq percent confirming: | 98.4848 |
| LEAP-Seq n confirming: | 65 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCACAGTTGTCAACAGCC |
| Suggested primer 2: | AGGTCACCAAGCATCACCTG |