| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.063215 |
| Chromosome: | chromosome 11 |
| Location: | 3067585 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g474850 | PUS17 | (1 of 2) 5.4.99.29 - 23S rRNA pseudouridine(746) synthase / 23S RNA Psi(746) synthase; RNA pseudouridine synthase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGAATGAAAATCGCAAAACCATGTCATGCATGAATTGGACCGCGAGTT |
| Internal bar code: | TGATCCGATCAGTAGTGTATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4190 |
| LEAP-Seq percent confirming: | 95.3488 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTATAGCGCCCCGAACC |
| Suggested primer 2: | GGCGCTATACGTGGCTGTAT |