Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.063258 |
Chromosome: | chromosome 12 |
Location: | 4549882 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g521350 | SLY1 | (1 of 1) PTHR11679:SF2 - SEC1 FAMILY DOMAIN-CONTAINING PROTEIN 1; SM/Sec1-family protein, SLY1 homolog | 5'UTR |
Cre12.g521400 | (1 of 1) 6.3.5.11 - Cobyrinate a,c-diamide synthase (glutamine-hydrolyzing) / Cobyrinic acid a,c-diamide synthetase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACCAAAAGCCTTCAATGAGCGAATAGGAAATGCCGCGAGCGCTGTTTA |
Internal bar code: | TAGGTGGCGTCCCTGTTAATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1489 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAACGGGTCCGAATTCACA |
Suggested primer 2: | ACCTCTCCACCTGATACCCC |