Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.063274 |
Chromosome: | chromosome 3 |
Location: | 7653465 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g204150 | FAP167,IFT80 | Intraflagellar transport protein 80; (1 of 1) PTHR24098//PTHR24098:SF0 - FAMILY NOT NAMED // OSEG5 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACACATGCTGCACGCTACATTGTAAATCGGTCTGTGGCCTCATGCTG |
Internal bar code: | AGTTGACCAAGATTTTCATTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1025 |
LEAP-Seq percent confirming: | 85.7143 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCCCTCACCTCTTCCCTCC |
Suggested primer 2: | TAGGCTCCAAGCACAGAAGC |