Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.063285 |
Chromosome: | chromosome 9 |
Location: | 4117178 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g399326 | MITC3, MCP3 | (1 of 2) K15110 - solute carrier family 25 (mitochondrial 2-oxodicarboxylate transporter), member 21 (SLC25A21, ODC); Mitochondrial substrate carrier protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCTTATGTCTTGGGCGAGGACTAGAGGAGAGTGAGGGAATTGAAAGG |
Internal bar code: | ACGCATCTTAAGGGTGCCAGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4828 |
LEAP-Seq percent confirming: | 98.8095 |
LEAP-Seq n confirming: | 83 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 84 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCCAGGTTACAGCCCATC |
Suggested primer 2: | CCGACTTCAGACGTGGTGAA |