Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.063310 |
Chromosome: | chromosome 12 |
Location: | 2760450 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g504200 | RPS23 | (1 of 1) K02973 - small subunit ribosomal protein S23e (RP-S23e, RPS23); Cytosolic 80S ribosomal protein S23 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGCGCGGACTTGGGGCGGGCCGTCCCCACCAGTCTCCCTCTTTCTTT |
Internal bar code: | GGAGCGCTCAAAACAGCTTTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 798 |
LEAP-Seq percent confirming: | 60.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAAGGCGGCAATCTTCTTG |
Suggested primer 2: | CACACATTCTGGTCGTCCCA |