| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.063372 |
| Chromosome: | chromosome 2 |
| Location: | 7250493 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391171 | (1 of 4) 6.3.5.4 - Asparagine synthase (glutamine-hydrolyzing) / Glutamine-dependent asparagine synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGTTGTGGTGGTGGTGGTGTAAAACAGTCTCTGTGCACGGCCTGGATA |
| Internal bar code: | TTTCTCGTGCGGTGATTCATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1633 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAAACACGGTTTCAACGCT |
| Suggested primer 2: | AACTGTTGGCACTGGTTCCA |