| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.063387 |
| Chromosome: | chromosome 16 |
| Location: | 4909205 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686800 | PTA2 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain; Proton/phosphate symporter, splice variant b | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATAAAGCATCATGCACAAGACCAGGCAGTCATTTCCAAACCCCAAGCTA |
| Internal bar code: | CAGAGGTTTGCCGCTTTAGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2117 |
| LEAP-Seq percent confirming: | 95.6522 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGCAAGAACTACCAGGTG |
| Suggested primer 2: | GAAACACCAACCGTCTTGCC |