| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.063613 |
| Chromosome: | chromosome 16 |
| Location: | 5371894 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683350 | TEH6 | Acyl-CoA thioesterase-like protein; (1 of 2) K17361 - acyl-coenzyme A thioesterase 9 [EC:3.1.2.-] (ACOT9) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTTGGAAAAAGTTAATGATAATTCGCGTTCCAAATGAAAAAAACTTAA |
| Internal bar code: | GCAAAATAGATGGTATAAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2195 |
| LEAP-Seq percent confirming: | 95.9184 |
| LEAP-Seq n confirming: | 47 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCACTCGCTCAAACTCAGT |
| Suggested primer 2: | CAGTTTTGCGTTCGTGAGCA |