| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.063628 |
| Chromosome: | chromosome 17 |
| Location: | 2578260 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g716200 | SUMO89B,SUM6 | Similar to Small ubiquitin-like modifier; (1 of 4) PF03171//PF11976 - 2OG-Fe(II) oxygenase superfamily (2OG-FeII_Oxy) // Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAGGAATGTACGTAATGGAGTGGACCGCGTGGTACAAATCTTGGGTT |
| Internal bar code: | TCTTCGGTGTCTCATTTCGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1778 |
| LEAP-Seq percent confirming: | 92.5926 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGTCCATCACACGGTCAG |
| Suggested primer 2: | GGTGAAGCAAACGACCCAAC |