| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.063686 |
| Chromosome: | chromosome 2 |
| Location: | 5746874 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g116750 | ATP1A | Mitochondrial F1F0 ATP synthase, alpha subunit; (1 of 1) K02132 - F-type H+-transporting ATPase subunit alpha (ATPeF1A, ATP5A1, ATP1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGCCTCATCCCCCGCACACACTCCGCAGCGCACGCCACGGCCCCCAC |
| Internal bar code: | GGCCGGTCCTCGTGACCAGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2696 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATCCTGAAGCACGTGGAC |
| Suggested primer 2: | GGGTAGGTTGTGACTCGCAA |