| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.063714 |
| Chromosome: | chromosome 6 |
| Location: | 6266330 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g292350 | AOC4 | (1 of 1) PTHR11785//PTHR11785:SF355 - AMINO ACID TRANSPORTER // SUBFAMILY NOT NAMED; Amino acid carrier | 5'UTR |
| Cre06.g292400 | SOUL5 | (1 of 8) PF10184 - Uncharacterized conserved protein (DUF2358) (DUF2358); DUF2358 domain protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTATCACCCGATTACGAACTTCGAATACAAAAAGACAATAGACGGATT |
| Internal bar code: | AAGTCCAAGGCTATGGTCTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2043 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGATTGAAGCCAGGATCT |
| Suggested primer 2: | TCGACACACCAGTTCGTCAG |