| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.063765 |
| Chromosome: | chromosome 11 |
| Location: | 2140414 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467743 | (1 of 3) PF04434 - SWIM zinc finger (SWIM) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCTAGCTTACTGCTGCCGTCGCTCTTCATCCAGGTTGCCACCAGCCGG |
| Internal bar code: | TACCGTCAGGCGGGGCACGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 262 |
| LEAP-Seq percent confirming: | 15.7895 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAAGCGTGGCAAAGAACG |
| Suggested primer 2: | CGCACCACAACCTACCTCAT |