| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.063817 |
| Chromosome: | chromosome 11 |
| Location: | 217607 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467554 | (1 of 15) PF01694 - Rhomboid family (Rhomboid) | 3'UTR | |
| Cre11.g467555 | (1 of 1) PF00023//PF13857 - Ankyrin repeat (Ank) // Ankyrin repeats (many copies) (Ank_5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCCGCCCACCTTCCAACTGTAAACAAGGGCCCAACATCCATCAACGC |
| Internal bar code: | CGCTTTGTCATAATTATCCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1877 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACTAGCTGCGCATCGTGA |
| Suggested primer 2: | CGTGCATTATTGGGCAGTCG |