Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.063819 |
Chromosome: | chromosome 16 |
Location: | 7396983 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g680454 | (1 of 8) PF13417 - Glutathione S-transferase, N-terminal domain (GST_N_3) | 3'UTR | |
Cre16.g680566 | (1 of 2) K17506 - protein phosphatase 1L [EC:3.1.3.16] (PPM1L, PP2CE) | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCGGGTCAATCCAGAGACGGCCTGCTCAGCGCATGGCCATGGCGGTGA |
Internal bar code: | TGGCAACAGTGTCATGGGCTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1365 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGGGAAGTTCGGAGTGAA |
Suggested primer 2: | TGTTGAATCTCCACGCGTCA |