| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.063831 |
| Chromosome: | chromosome 14 |
| Location: | 1930194 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g620350 | GCH3 | (1 of 1) K14652 - 3,4-dihydroxy 2-butanone 4-phosphate synthase / GTP cyclohydrolase II (ribBA); Putative GTP cyclohydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCATTGGCATGTGCTGTAATGTGGAAAGTACCGTACCCAAATAGCGGA |
| Internal bar code: | TATCAAACTGACGATAAGCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2308 |
| LEAP-Seq percent confirming: | 97.7778 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGTGCTGCCTAGTAGGAT |
| Suggested primer 2: | AGAGGACAAGCAACGTGAGG |