| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.063836 |
| Chromosome: | chromosome 11 |
| Location: | 410863 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g801231 | (1 of 41) IPR000719//IPR011009 - Protein kinase domain // Protein kinase-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTACTATTAGATTGCTTTGACCTGCTTGTGTCAGCCGATATTGTCTT |
| Internal bar code: | TTGGTGGTGTTGTACTATCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2186 |
| LEAP-Seq percent confirming: | 4.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCAATCGGTGCGTATGC |
| Suggested primer 2: | GAGTAGGGCTTGCTCGCTAG |