| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.063898 |
| Chromosome: | chromosome 11 |
| Location: | 4437930 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g483351 | PHC44 | Putative pherophorin-chlamydomonas homolog; (1 of 1) IPR003072//IPR003882//IPR024616 - Orphan nuclear receptor, NOR1 type // Pistil-specific extensin-like protein // Pherophorin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGCCCTCCTCCCTCGCCTGTGCCTCCGTCTCCCACGCCCCCCAGCCC |
| Internal bar code: | GTCTTCTCTCAGAGCTGGAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1549 |
| LEAP-Seq percent confirming: | 5.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGAGGAGGGTAAGGAGG |
| Suggested primer 2: | GGTTAAGCCATGCTGATGCG |