Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.064053 |
Chromosome: | chromosome 6 |
Location: | 7972785 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g304500 | ZYS3-2,EZY9,ZYS4 | (1 of 2) PF00397//PF12796 - WW domain (WW) // Ankyrin repeats (3 copies) (Ank_2); Zygote-specific protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTCCTGTGCCCCAAGAAGTCACTCCAAATGTAGGGAGTTATAGTTGA |
Internal bar code: | GGAATTTTCGATACAAGGGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1696 |
LEAP-Seq percent confirming: | 95.082 |
LEAP-Seq n confirming: | 58 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGCAGTTGCAGTACCTGAT |
Suggested primer 2: | GCCTCCCTCACCTTCTTTCC |