Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.064085 |
Chromosome: | chromosome 3 |
Location: | 7247357 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g207700 | FPPS1,FPPS,PPS1,FPS1 | (1 of 1) 2.5.1.1//2.5.1.10 - Dimethylallyltranstransferase / Prenyltransferase // (2E,6E)-farnesyl diphosphate synthase / Geranyltranstransferase; Farnesyl pyrophosphate synthase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCCGCAGGTGCCATCCGCGATCCATAACTTATTACGTGCGCAGGAAC |
Internal bar code: | GACCACTTCGGAGTGTTAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2899 |
LEAP-Seq percent confirming: | 89.899 |
LEAP-Seq n confirming: | 89 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 99 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCATGGATAGCTGCAGGGG |
Suggested primer 2: | CGGGGTAACAGGTCACGAAA |