| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.064190 |
| Chromosome: | chromosome 2 |
| Location: | 1186361 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081350 | (1 of 1) PTHR11080//PTHR11080:SF2 - PYRAZINAMIDASE/NICOTINAMIDASE // PROTEIN PNC-1, ISOFORM A; Nicotinamidase | 3'UTR | |
| Cre02.g081400 | BCA1 | Branched chain amino acid aminotransferase; (1 of 1) 2.6.1.88 - Methionine transaminase / Methionine-oxo-acid transaminase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGGTCGCGCCTGATACTGCAGGGGTGCGAGCAGCGGGGACGCGATTGT |
| Internal bar code: | ATGGGCGTAACACATCCTTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1407 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAACACACGGCACCTTTG |
| Suggested primer 2: | CAAGTGAACAGTGGCGTGTG |