| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.064197 |
| Chromosome: | chromosome 16 |
| Location: | 2366900 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g659350 | CYB5-1,CYB1 | (1 of 14) PF00173 - Cytochrome b5-like Heme/Steroid binding domain (Cyt-b5); Cytochrome b5 flavohemoprotein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCCGCTCCTGGCACTGTTTCAAAATGACCGGCCATGAGCCGACATGCC |
| Internal bar code: | CGCACTACGGCTCGTGAAAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1342 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 90 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 99 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATGGTGATGCTCGCAAAG |
| Suggested primer 2: | ATGGTTCCCTACGCTGTTGG |