| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.064198 |
| Chromosome: | chromosome 17 |
| Location: | 4668765 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g732600 | GOX5 | Glyoxal oxidase 5; (1 of 1) IPR009880//IPR011043//IPR014756//IPR015202//IPR016187 - Glyoxal oxidase, N-terminal // Galactose oxidase/kelch, beta-propeller // Immunoglobulin E-set // Domain of unknown function DUF1929 // C-type lectin fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGTGTGCGTGTGTGTGTGATGGTGTGAGACATTCGTGTGTGTGTGT |
| Internal bar code: | GGTATAAGGGTGCAATCCGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1011 |
| LEAP-Seq percent confirming: | 1.36986 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 72 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCGAGTAATCGAGCGAGT |
| Suggested primer 2: | CTTCTCCACGAACCACACGA |