| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.064208 |
| Chromosome: | chromosome 7 |
| Location: | 1140703 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g320800 | (1 of 1) PF09468 - Ydr279p protein family (RNase H2 complex component) (RNase_H2-Ydr279) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCTCAATTCCATAACAAGCGCTCTGCACACTAAGCCCCCATTCCGTAC |
| Internal bar code: | GACACAGGCGGGCGCCGAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2087 |
| LEAP-Seq percent confirming: | 91.4286 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGGACGATTGGATTGCGA |
| Suggested primer 2: | AAGCGTTGCCTTTTGCGATT |