Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.064209 |
Chromosome: | chromosome 16 |
Location: | 5815649 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g680000 | ATP5 | (1 of 1) K02137 - F-type H+-transporting ATPase subunit O (ATPeF0O, ATP5O, ATP5); Mitochondrial ATP synthase subunit 5, OSCP subunit | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCGTGCGCCTGAGGTGGCAGCGGCTTATGTTACTAGCTAGGGGGTAG |
Internal bar code: | TGTTGTCTAGGGGCGGGCCCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2072 |
LEAP-Seq percent confirming: | 97.8261 |
LEAP-Seq n confirming: | 45 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGGCAGGCACTTGACACAG |
Suggested primer 2: | CAGTGAGGGGTGGTGCTAAG |