Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.064227 |
Chromosome: | chromosome 12 |
Location: | 2658724 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g505500 | HTR17 | Histone H3; (1 of 35) K11253 - histone H3 (H3) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCTTCTTTTTCTAGTCTCCCAATCAACTATCCAAGATGGCCCGCACCA |
Internal bar code: | CGCGAGAACCTGTTTCCGTTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3735 |
LEAP-Seq percent confirming: | 86.5672 |
LEAP-Seq n confirming: | 58 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACTCTAGCCAGCTCTAGC |
Suggested primer 2: | CGGATAGCGGGCTTGGTAAT |