| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.064258 |
| Chromosome: | chromosome 7 |
| Location: | 5476381 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g351050 | VPS23 | (1 of 1) K12183 - ESCRT-I complex subunit TSG101 (TSG101, STP22, VPS23); Subunit of the ESCRT-I complex | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAAGGCAAGGCGGGAAGTAATGGACGCAGGTGGGGCCGTGGGGGGCAA |
| Internal bar code: | TCGCGCAGATCGGCCGTTTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2020 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTGTGAGACGACGTCAA |
| Suggested primer 2: | GCTTCTTTGCCTTGACTGCC |