Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.064268 |
Chromosome: | chromosome 12 |
Location: | 7257027 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g558650 | EIF2B,EIF2BD | (1 of 1) K03680 - translation initiation factor eIF-2B subunit delta (EIF2B4); eIF-2B delta subunit | 5'UTR |
Cre12.g558700 | FAP67 | Flagellar Associated Protein 67; (1 of 4) K00940 - nucleoside-diphosphate kinase (ndk, NME) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATAGTGCAAATTCATCCAATGATCATGCCTCTCCAACATAAACTGGAAT |
Internal bar code: | GTTAACTACTGTATGTTTTTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 447 |
LEAP-Seq percent confirming: | 85.7143 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCACGACCATAGCATCCC |
Suggested primer 2: | TATGCACGTGGCCACAGATT |