| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.064270 |
| Chromosome: | chromosome 3 |
| Location: | 6902735 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g198150 | OXA1,ALB3C | ALBINO3-like translocon protein; (1 of 5) IPR001708 - Membrane insertase OXA1/ALB3/YidC | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATTGCGCGCGAGGTCGCTTCTCGCTCCGCCTGAGTTTTTATACTAAT |
| Internal bar code: | CAATCGTCGAAGGGGGTAATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1167 |
| LEAP-Seq percent confirming: | 5.76923 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCACTGGGCCTTATGCTG |
| Suggested primer 2: | CAAACACTGCGTGAACCCTG |