Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.064284 |
Chromosome: | chromosome 16 |
Location: | 6746993 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g672650 | MITC14,MCP14 | Mitochondrial substrate carrier protein; (1 of 1) K15104 - solute carrier family 25 (mitochondrial oxoglutarate transporter), member 11 (SLC25A11, OGC) | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACGCCTGGCCTTACATTGCCGGATTGAAGGCTGGGGAACGTCAGAAGC |
Internal bar code: | GAATGCGTAAACTTAGTGGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5682 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTGGTGTGTGAGTGTGCA |
Suggested primer 2: | CCCACGGTAATAGGGCCATC |