Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.064307 |
Chromosome: | chromosome 3 |
Location: | 6759778 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g196550 | Found in Chlamydomonas, Volvox and Micromonas but not strongly conserved elsewhere; (1 of 5) PF03992 - Antibiotic biosynthesis monooxygenase (ABM) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGAGTGACCCGCAAGCCCACAGATGCGGGTTGGGATATGCATTTTTCA |
Internal bar code: | CGTTGCTGGCATTGGATTGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2738 |
LEAP-Seq percent confirming: | 93.3333 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTATGAGAACGGGCCAGGA |
Suggested primer 2: | ATGCTTAGCGTCTCATCCGG |