| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.064317 |
| Chromosome: | chromosome 9 |
| Location: | 1430625 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399907 | (1 of 1) PTHR23240//PTHR23240:SF10 - DNA CROSS-LINK REPAIR PROTEIN PSO2/SNM1-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCCAACCACCCCAGCCAACCACCCCAGCCCAACCACCCCAGCCCAACC |
| Internal bar code: | CGTTAGTATATTAGGAAGACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 354 |
| LEAP-Seq percent confirming: | 60.8696 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCAGACCACTACAAGGTG |
| Suggested primer 2: | GGACCGTGTGTGTGTGTTTG |