| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.064319 |
| Chromosome: | chromosome 12 |
| Location: | 7261308 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558650 | EIF2B,EIF2BD | (1 of 1) K03680 - translation initiation factor eIF-2B subunit delta (EIF2B4); eIF-2B delta subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGCTGAAGGTGCGGTTATGTACTAGCCTGTGCATTTCAGGTACACGCC |
| Internal bar code: | CCAGAGTGGTTTACTAACTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2275 |
| LEAP-Seq percent confirming: | 98.3871 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACTTTCACGCACACAGGG |
| Suggested primer 2: | CAAGCTCAAGGATGCTGGGA |