| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.064341 |
| Chromosome: | chromosome 6 |
| Location: | 7423814 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300450 | (1 of 14) IPR003593//IPR003959//IPR027417 - AAA+ ATPase domain // ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase | 3'UTR | |
| Cre06.g300500 | ADCY1,CYA18 | Adenylyl cyclase; (1 of 1) PTHR11347//PTHR11347:SF132 - CYCLIC NUCLEOTIDE PHOSPHODIESTERASE // PDE1C, ISOFORM E | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACGGCCCCCGCACACGGTTGACCATGTTGAGCGACGGACCGACCGGGA |
| Internal bar code: | GAGGCGTCTAGATAACGTTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1569 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATGGGTGGATGGACTGA |
| Suggested primer 2: | GAATGCTGGGGCCTTTTTGG |