| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.064360 |
| Chromosome: | chromosome 12 |
| Location: | 9672746 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557078 | (1 of 4) 1.14.17.1 - Dopamine beta-monooxygenase / Dopamine beta-hydroxylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGAGTCCCCGACGTGTCAAATTCATGGTCACACAACGCGTTGCATGCC |
| Internal bar code: | AGCGGCCCCTAGGCAGTAGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1255 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGCTCCGTCTATCCTAAC |
| Suggested primer 2: | TACGTCACACACACACGGAG |