Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.064377 |
Chromosome: | chromosome 6 |
Location: | 7168854 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g298400 | (1 of 34) IPR001878 - Zinc finger, CCHC-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGACTATGATGCTAGCTCCGATGTGATGTGAACGGCCACGTTGGGCTGT |
Internal bar code: | GAGGGGTGGTTTCTTGCGTGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3689 |
LEAP-Seq percent confirming: | 42.8571 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACTACCGGCATCATAGCT |
Suggested primer 2: | GGCCATTGCAGAGGAGTTCT |