| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.064467 |
| Chromosome: | chromosome 2 |
| Location: | 1344786 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g082865 | (1 of 10) PF07460 - NUMOD3 motif (2 copies) (NUMOD3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTACCAGTCCTTCATTGCGCCGCCCAGCCTAACGCCCGGTAAGGTACA |
| Internal bar code: | TATAGGGTCGAAGTCAGGTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2381 |
| LEAP-Seq percent confirming: | 95.1613 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACAAGAACAATCCGCGG |
| Suggested primer 2: | TCAGTCGTCTAGGTCCAGCA |