Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.064473 |
Chromosome: | chromosome 10 |
Location: | 6694972 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g466550 | TF2H1 | General transcription factor IIH subunit 1; (1 of 1) IPR005607//IPR027079 - BSD domain // TFIIH subunit Tfb1/p62 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGAGCTAGTACGCTCACATAACCAAGCGCGCTCAACCCTGCTCCCAGT |
Internal bar code: | GTTCTATAACCTACCTCGGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 361 |
LEAP-Seq percent confirming: | 16.6667 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCCTGTCTCTCTTGACCC |
Suggested primer 2: | GCCCGTGTGATGTCCACTAA |