| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.064494 |
| Chromosome: | chromosome 7 |
| Location: | 5865949 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g353750 | MMP10 | Metalloproteinase of VMP family; (1 of 40) 3.4.24.38 - Gametolysin / Lysin | intron |
| Cre07.g800865 | (1 of 9) IPR000477//IPR000536//IPR001584//IPR012337//IPR021109 - Reverse transcriptase domain // Nuclear hormone receptor, ligand-binding domain // Integrase, catalytic core // Ribonuclease H-like domain // Aspartic peptidase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAGCCGCTGTAAGGGTGAGGCAGGGTGGCCAGCTTGGGGCTCAGCCCT |
| Internal bar code: | ATTATGTCTGATACTAAGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 164 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGGGCGTATGTCCACTTT |
| Suggested primer 2: | CACGTCTTCTGACACCTCCC |