| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.064515 |
| Chromosome: | chromosome 7 |
| Location: | 1451235 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g323650 | (1 of 1) PTHR13109//PTHR13109:SF7 - NEUROCHONDRIN // NEUROCHONDRIN | 3'UTR | |
| Cre07.g323700 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCACGCTCGCCCTAATCTACTGGCCCCTCCCAACCCTTGCGCCCTCGCC |
| Internal bar code: | GAACTGAACGTATTGCACAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1722 |
| LEAP-Seq percent confirming: | 78.9474 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAGTAGCAGCAGTAGCA |
| Suggested primer 2: | CATGACTCCCTGACGCTCTC |