| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.064548 |
| Chromosome: | chromosome 16 |
| Location: | 3967781 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689600 | MIA2,FAP73 | (1 of 2) PF13863 - Domain of unknown function (DUF4200) (DUF4200); MIA2 subunit of the modifier of inner arms (MIA) complex | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTCTGAATATGAAGCACACTTGAAATACACGGGAAATTGCTCGGCTT |
| Internal bar code: | AGGTTTGAGCCTCAGTATGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2138 |
| LEAP-Seq percent confirming: | 55.1724 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGACCCCTTACCGCATGTT |
| Suggested primer 2: | GCTCGCCTAGTACCGGTTAC |